HomeAll softwareProductsNew ProductsServicesManagement teamCorporate ProfileContact

Test online

Gene finding
Gene finding with similarity
Gene finding in Bacteria
Gene finding in Viruses
Next Generation
Gene search
Gene explorer
Promoter
Protein location
RNA structure
Protein structure
3d-explorer
SeqMan
Multiple alignment
Analysis of expression data
Plant promoter database
Search and map repeats
Extracting known SNPs

 

 

SMAP - mapping oligonucleotides to genome

The program maps a short sequence to a specified genome and outputs the list of the chromosome regions where the sequence of interest is found at a certain degree of homology.

Program options:
Search uniqueness - searching for the sequence in the genome.
Generate new sequence - generating the file reporting the number of copies of the sequence specified found in the genome (see output example).
Verbose alignment output - supplementing the result with sequences of block alignments.

Output example with "Search uniqueness" option:

Sequence 1 found: 18
L:246127941  Sequence chr1
[DD] Sequence:       1(      1), S:      6.1546, L:22 cut1 of chr22
Block of alignment: 1        
    1 P: 24680544       1 L:      22, G:  81.818, W:    100, S:6.15457
[DR] Sequence:       1(      1), S:      6.1546, L:22 cut1 of chr22
Block of alignment: 1        
    1 P: 75846196       1 L:      22, G:  81.818, W:    100, S:6.15457
L:199344050  Sequence chr3
[DD] Sequence:       1(      1), S:      8.1104, L:22 cut1 of chr22
Block of alignment: 2        
    1 P: 115760898       1 L:      22, G:  81.818, W:    100, S:6.15457
    2 P: 45403606       1 L:      22, G:  81.818, W:    100, S:6.15457
[DR] Sequence:       1(      1), S:      6.1546, L:22 cut1 of chr22
Block of alignment: 1        
    1 P: 169316451       1 L:      22, G:  81.818, W:    100, S:6.15457
L:181034922  Sequence chr5
[DR] Sequence:       1(      1), S:      6.1546, L:22 cut1 of chr22
Block of alignment: 1        
    1 P: 135748025       1 L:      22, G:  81.818, W:    100, S:6.15457
L:170914576  Sequence chr6
[DD] Sequence:       1(      1), S:      6.1546, L:22 cut1 of chr22
Block of alignment: 1        
    1 P: 128565689       1 L:      22, G:  81.818, W:    100, S:6.15457
L:158545518  Sequence chr7
[DR] Sequence:       1(      1), S:      6.1546, L:22 cut1 of chr22
Block of alignment: 1        
    1 P: 54503919       1 L:      22, G:  81.818, W:    100, S:6.15457
L:146308819  Sequence chr8
[DR] Sequence:       1(      1), S:      6.1546, L:22 cut1 of chr22
Block of alignment: 1        
    1 P: 10488747       1 L:      22, G:  81.818, W:    100, S:6.15457
L:134482954  Sequence chr11
[DD] Sequence:       1(      1), S:      6.1546, L:22 cut1 of chr22
Block of alignment: 1        
    1 P: 69945455       1 L:      22, G:  81.818, W:    100, S:6.15457
L:105311216  Sequence chr14
[DR] Sequence:       1(      1), S:      8.1104, L:22 cut1 of chr22
Block of alignment: 2        
    1 P: 44339778       1 L:      22, G:  81.818, W:    100, S:6.15457
    2 P: 92116275       1 L:      22, G:  81.818, W:    100, S:6.15457
L:100256656  Sequence chr15
[DR] Sequence:       1(      1), S:      6.1546, L:22 cut1 of chr22
Block of alignment: 1        
    1 P: 34423244       1 L:      22, G:  81.818, W:    100, S:6.15457
L:90041932   Sequence chr16
[DR] Sequence:       1(      1), S:      9.9494, L:22 cut1 of chr22
Block of alignment: 3        
    1 P: 80986058       1 L:      22, G:  81.818, W:    100, S:6.15457
    2 P: 88046952       1 L:      22, G:  86.364, W:    130, S:6.64694
    3 P: 29307765       1 L:      22, G:  81.818, W:    100, S:6.15457
L:81860266   Sequence chr17
[DD] Sequence:       1(      1), S:      6.1546, L:22 cut1 of chr22
Block of alignment: 1        
    1 P: 55043280       1 L:      22, G:  81.818, W:    100, S:6.15457
L:49396972   Sequence chr22
[DD] Sequence:       1(      1), S:       8.124, L:22 cut1 of chr22
Block of alignment: 1        
    1 P: 49014410       1 L:      22, G: 100.000, W:    220, S:8.12404

where: "Sequence 1 found: 18" - the number of copies of target sequence 1 found in the genome; "L:246127941 Sequence chr1" - the length and name of the chromosome whereto the target sequence aligned; "[DD]" - directions of the chromosome strand and target sequence; "Sequence: 1( 1)" - alignment number within particular site; "S: 6.1546" - alignment score; "L:22 cut1 of chr22" - alignment length; "Block of alignment: 1" - number of alignment blocks found; "1 Ð: 24680544 1" - positions of alignment blocks on the chromosome and in the target sequence; "L: 22" - length of alignment block; "G: 81.818" - degree of homology of alignment block; "W: 100" - weight of alignment block; "S:6.15457" - score value of alignment block.

Output example with "Generate new sequence" option:

>cut1 of chr22|in hg16 found 18
ggggtccttgaagaatgaggcg
>cut2 of chr22|in hg16 found 12
gactgtgtccagtgtgag
>cut3 of chr22|in hg16 found 54
gcgcccccgcctgacc
© 2021 www.softberry.com