|
|
SMAP - mapping oligonucleotides to genome
The program maps a short sequence to a specified genome and outputs the list of the chromosome regions where the sequence of interest is found at a certain degree of homology.
Program options:
Search uniqueness - searching for the sequence in the genome.
Generate new sequence - generating the file reporting the number of copies of the sequence specified found in the genome (see output example).
Verbose alignment output - supplementing the result with sequences of block alignments.
Output example with "Search uniqueness" option:
Sequence 1 found: 18
L:246127941 Sequence chr1
[DD] Sequence: 1( 1), S: 6.1546, L:22 cut1 of chr22
Block of alignment: 1
1 P: 24680544 1 L: 22, G: 81.818, W: 100, S:6.15457
[DR] Sequence: 1( 1), S: 6.1546, L:22 cut1 of chr22
Block of alignment: 1
1 P: 75846196 1 L: 22, G: 81.818, W: 100, S:6.15457
L:199344050 Sequence chr3
[DD] Sequence: 1( 1), S: 8.1104, L:22 cut1 of chr22
Block of alignment: 2
1 P: 115760898 1 L: 22, G: 81.818, W: 100, S:6.15457
2 P: 45403606 1 L: 22, G: 81.818, W: 100, S:6.15457
[DR] Sequence: 1( 1), S: 6.1546, L:22 cut1 of chr22
Block of alignment: 1
1 P: 169316451 1 L: 22, G: 81.818, W: 100, S:6.15457
L:181034922 Sequence chr5
[DR] Sequence: 1( 1), S: 6.1546, L:22 cut1 of chr22
Block of alignment: 1
1 P: 135748025 1 L: 22, G: 81.818, W: 100, S:6.15457
L:170914576 Sequence chr6
[DD] Sequence: 1( 1), S: 6.1546, L:22 cut1 of chr22
Block of alignment: 1
1 P: 128565689 1 L: 22, G: 81.818, W: 100, S:6.15457
L:158545518 Sequence chr7
[DR] Sequence: 1( 1), S: 6.1546, L:22 cut1 of chr22
Block of alignment: 1
1 P: 54503919 1 L: 22, G: 81.818, W: 100, S:6.15457
L:146308819 Sequence chr8
[DR] Sequence: 1( 1), S: 6.1546, L:22 cut1 of chr22
Block of alignment: 1
1 P: 10488747 1 L: 22, G: 81.818, W: 100, S:6.15457
L:134482954 Sequence chr11
[DD] Sequence: 1( 1), S: 6.1546, L:22 cut1 of chr22
Block of alignment: 1
1 P: 69945455 1 L: 22, G: 81.818, W: 100, S:6.15457
L:105311216 Sequence chr14
[DR] Sequence: 1( 1), S: 8.1104, L:22 cut1 of chr22
Block of alignment: 2
1 P: 44339778 1 L: 22, G: 81.818, W: 100, S:6.15457
2 P: 92116275 1 L: 22, G: 81.818, W: 100, S:6.15457
L:100256656 Sequence chr15
[DR] Sequence: 1( 1), S: 6.1546, L:22 cut1 of chr22
Block of alignment: 1
1 P: 34423244 1 L: 22, G: 81.818, W: 100, S:6.15457
L:90041932 Sequence chr16
[DR] Sequence: 1( 1), S: 9.9494, L:22 cut1 of chr22
Block of alignment: 3
1 P: 80986058 1 L: 22, G: 81.818, W: 100, S:6.15457
2 P: 88046952 1 L: 22, G: 86.364, W: 130, S:6.64694
3 P: 29307765 1 L: 22, G: 81.818, W: 100, S:6.15457
L:81860266 Sequence chr17
[DD] Sequence: 1( 1), S: 6.1546, L:22 cut1 of chr22
Block of alignment: 1
1 P: 55043280 1 L: 22, G: 81.818, W: 100, S:6.15457
L:49396972 Sequence chr22
[DD] Sequence: 1( 1), S: 8.124, L:22 cut1 of chr22
Block of alignment: 1
1 P: 49014410 1 L: 22, G: 100.000, W: 220, S:8.12404
where:
"Sequence 1 found: 18" - the number of copies of target sequence 1 found in the genome;
"L:246127941 Sequence chr1" - the length and name of the chromosome whereto the target sequence aligned;
"[DD]" - directions of the chromosome strand and target sequence;
"Sequence: 1( 1)" - alignment number within particular site;
"S: 6.1546" - alignment score;
"L:22 cut1 of chr22" - alignment length;
"Block of alignment: 1" - number of alignment blocks found;
"1 Ð: 24680544 1" - positions of alignment blocks on the chromosome and in the target sequence;
"L: 22" - length of alignment block;
"G: 81.818" - degree of homology of alignment block;
"W: 100" - weight of alignment block;
"S:6.15457" - score value of alignment block.
Output example with "Generate new sequence" option:
>cut1 of chr22|in hg16 found 18
ggggtccttgaagaatgaggcg
>cut2 of chr22|in hg16 found 12
gactgtgtccagtgtgag
>cut3 of chr22|in hg16 found 54
gcgcccccgcctgacc
|
