SCAN2

Program for aligning two multimegabyte-size genome sequences using a sequential search for most significant similarity regions. Program is provided with viewer.

Example of output:

L:73308      Sequence gi|455025|gb|U01317.1|HUMHBB Human beta globin region on chromosome 11 
vs. 2 Base sequences [/home/apache/tmp/EP1IwQ.scan2].
[DD] Sequence:       1(      1), S:      155.86, L:    57113 
gi|1418273|gb|U60902.1|OCU60902 Otolemur crassicaudatus epsilon-, gamma-, delt
        1 ---------------(..)-gaattctaatctccCTCTCAACCCtacagtcacccattt(
        1 attaatagttgacag(..)gcccttgactatacaCTCTCAACCCagtttccatagctga(

      515 ..)ttagattaattttgtAATATTGATATTATTCCTAGAAAGCTGAGGCCTCAAGATGAT
     2267 ..)aatcattagcttgacAATATTGATATTATCAATAGAAGGTTGAGGCCTAAAGGTGAT

      572 AACTTTTATTttctggacttgtaat(..)aatttatgggaaaacAAGTATGTACTTTTTC
     2324 GACTTTTATTcatttatttacttag(..)atttatgagaaaagaAAGTATACACTTTACC

      756 TACTAAGCCATTGAAACAGGAATAACAGAACAAGATTGAAAGAATACATTTTCCGAAATT
     2494 TACTAAGCCATTGAAGCATGAATAATAAAACAAGATTAAAAAATAAATTTCTCAAAAATT

      816 ACTTGAGTATTATACAAAGACAAGCACGTGGACCTGGGAGgagggttattgtcca(..)t

Where:

1-st line is the header:

[DD] Sequence:  1(  1), S:  155.86, L: 57113 
gi|1418273|gb|U60902.1|OCU60902 Otolemur crassicaudatus epsilon-, gamma-, delt

[DD]	Target sequence in direct chain (D), query sequence in direct chain (D). Variants: [DR] - target sequence in direct chain (D), query sequence in reverse chain (R). [RD] - target sequence in reverse chain (R), query sequence in direct chain (D). [RR] - target sequence in reverse chain (R), query sequence in reverse chain (R).
Sequence: 1( 1)	Order number of sequence from a query set which is submitted to alignment. In brackets is an order number for alignment of this sequence (if it resulted in more than one alignment). Variants: 4(      5) - the fifth alignment of the fourth sequence from a set
S	Score of this alignment.
L	Length of this query sequence
gi|1418273|gb|U60902.1|OCU60902 Otolemur crassicaudatus epsilon-, gamma-, delt	Name of this query sequence

Alignment:

        1 ---------------(..)-gaattctaatctccCTCTCAACCCtacagtcacccattt(
        1 attaatagttgacag(..)gcccttgactatacaCTCTCAACCCagtttccatagctga(

1 line - The target sequence itself. Capital letters correspond to blocks of similarity, lower case - not aligned regions.
1 line - The query sequence itself. Capital letters correspond to blocks of similarity, lower case - not aligned regions.