HomeAll softwareProductsNew ProductsServicesManagement teamCorporate ProfileContact

Test online

Gene finding
Gene finding with similarity
Gene finding in Bacteria
Gene finding in Viruses
Next Generation
Gene search
Gene explorer
Promoter
Protein location
RNA structure
Protein structure
3d-explorer
SeqMan
Multiple alignment
Analysis of expression data
Plant promoter database
Search and map repeats
Extracting known SNPs

 

 

SCAN2

Program for aligning two multimegabyte-size genome sequences using a sequential search for most significant similarity regions. Program is provided with viewer.

Example of output:

L:73308 Sequence gi|455025|gb|U01317.1|HUMHBB Human beta globin region on chromosome 11 vs. 2 Base sequences [/home/apache/tmp/EP1IwQ.scan2]. [DD] Sequence: 1( 1), S: 155.86, L: 57113 gi|1418273|gb|U60902.1|OCU60902 Otolemur crassicaudatus epsilon-, gamma-, delt 1 ---------------(..)-gaattctaatctccCTCTCAACCCtacagtcacccattt( 1 attaatagttgacag(..)gcccttgactatacaCTCTCAACCCagtttccatagctga( 515 ..)ttagattaattttgtAATATTGATATTATTCCTAGAAAGCTGAGGCCTCAAGATGAT 2267 ..)aatcattagcttgacAATATTGATATTATCAATAGAAGGTTGAGGCCTAAAGGTGAT 572 AACTTTTATTttctggacttgtaat(..)aatttatgggaaaacAAGTATGTACTTTTTC 2324 GACTTTTATTcatttatttacttag(..)atttatgagaaaagaAAGTATACACTTTACC 756 TACTAAGCCATTGAAACAGGAATAACAGAACAAGATTGAAAGAATACATTTTCCGAAATT 2494 TACTAAGCCATTGAAGCATGAATAATAAAACAAGATTAAAAAATAAATTTCTCAAAAATT 816 ACTTGAGTATTATACAAAGACAAGCACGTGGACCTGGGAGgagggttattgtcca(..)t

Where:

1-st line is the header:

[DD] Sequence: 1( 1), S: 155.86, L: 57113 gi|1418273|gb|U60902.1|OCU60902 Otolemur crassicaudatus epsilon-, gamma-, delt

[DD]

Target sequence in direct chain (D), query sequence in direct chain (D). Variants:
[DR] - target sequence in direct chain (D), query sequence in reverse chain (R).
[RD] - target sequence in reverse chain (R), query sequence in direct chain (D).
[RR] - target sequence in reverse chain (R), query sequence in reverse chain (R).

Sequence: 1( 1)

Order number of sequence from a query set which is submitted to alignment. In brackets is an order number for alignment of this sequence (if it resulted in more than one alignment). Variants: 4(      5) - the fifth alignment of the fourth sequence from a set

S

Score of this alignment.

L

Length of this query sequence

gi|1418273|gb|U60902.1|OCU60902 Otolemur crassicaudatus epsilon-, gamma-, delt

Name of this query sequence

Alignment:

1 ---------------(..)-gaattctaatctccCTCTCAACCCtacagtcacccattt( 1 attaatagttgacag(..)gcccttgactatacaCTCTCAACCCagtttccatagctga(

1 line - The target sequence itself. Capital letters correspond to blocks of similarity, lower case - not aligned regions.
1 line - The query sequence itself. Capital letters correspond to blocks of similarity, lower case - not aligned regions.

© 2020 www.softberry.com