HomeAll softwareProductsNew ProductsServicesManagement teamCorporate ProfileContact

Test online

Gene finding
Gene finding with similarity
Gene finding in Bacteria
Gene finding in Viruses
Next Generation
Gene search
Gene explorer
Promoter
Protein location
RNA structure
Protein structure
3d-explorer
SeqMan
Multiple alignment
Analysis of expression data
Plant promoter database
Search and map repeats
Extracting known SNPs

 

 

EST_map

Program for mapping a whole set of mRNAs/ESTs to a chromosome sequence. For example, 11,000 sequences of full mRNAs from NCBI reference set were mapped to 52-MB unmasked Y chromosome fragment in about 18-25 min, depending on computer memory size. EstMap takes into account statistical features of splice sites for more accurate mapping.

EstMap is part of FGENESH++C genome annotation pipeline, where it maps RefSeq sequences to a query genome at very early stages of annotation.

Example of an output of the EstMap program:

L:49476872 Sequence chr22 vs. 2 Base sequences [/home/apache/tmp/RrdFeT.rnamap]. [DD] Sequence: 1( 1), S: 26.989, L: 360 AA704607 zj19g11.s1 Soares_fetal_liver_spleen_1NFLS_S1 Homo sapiens cDNA clone 1 nnnnnnnnnnnnnnn(..)ttttttttttttttt?[GAAGGTTTCAAATATACTTTATTT ...............(..)............... |||||||||||||0|||||||||| 1 ---------------(..)--------------- GAAGGTTTCAAATGTACTTTATTT 33914973 CTTCAATAAT]gtcatatcttttttt(..)ccacgcccggctaat[TCTTAATGGGCACA |||||||||| ...............(..)............... ||||||||||0||| 25 CTTCAATAAT gcc------------(..)------------ata TCTTAATGGGTACA 33915177 CAGTGCTTTCACTTGGCATCAATCATGAGCTGTTTTTTAAACAATTCGGTATTACACCAG |||||||||0|0|||||||||||0|||||||||||||||||||||||00||||||||||| 55 CAGTGCTTTAATTTGGCATCAATTATGAGCTGTTTTTTAAACAATTCATTATTACACCAG 33915237 CTGGAATGATCACTGATctatccgTCCT-------TTTGGGGTGGCTCAGCTAACAGGGG ||||0|||||0||||||.......||||.......||||||||00|||0||0|||||||| 115 CTGGGATGATTACTGAT-------TCCTccattccTTTGGGGTAACTCTGCCAACAGGGG 33915290 ATGGGTTCCATTCCATTTCGATTTGTGTTGCTACACTTGTCCATACAGCAGTACAGAAAG |00||||||||||0|||0|||0|||||||||||||00|||||||00|0||0||||||||| 168 ACAGGTTCCATTCTATTCCGACTTGTGTTGCTACATATGTCCATGTAACAATACAGAAAG 33915350 TGGCTCCACTAGCTAATACAGCATTACCATATCTGTCATGAAAATCAGGTGTACCTTTCT ||||||||||||||||||||||||||||0|||0|||||||||||||||||||||0||||| 228 TGGCTCCACTAGCTAATACAGCATTACCGTATTTGTCATGAAAATCAGGTGTACGTTTCT 33915410 GGTGGCTCTGCCTTGCCATTGTTTGCTGAATGCTTCGAACTTGGAGACGA]?cttgagtg |||||||||||00||||||||||||||||||||||||||||||||||||| ........ 288 GGTGGCTCTGCTCTGCCATTGTTTGCTGAATGCTTCGAACTTGGAGACGA tttagtgc 33915468 tgttttt(..)nnnnnnnnnnnnnnn .......(..)............... 346 gcttttg(..)---------------
© 2020 www.softberry.com