HomeAll softwareProductsNew ProductsServicesManagement teamCorporate ProfileContact

Test online

Gene finding
Gene finding with similarity
Gene finding in Bacteria
Gene finding in Viruses
Next Generation
Gene search
Gene explorer
Promoter
Protein location
RNA structure
Protein structure
3d-explorer
SeqMan
Multiple alignment
Analysis of expression data
Plant promoter database
Search and map repeats
Extracting known SNPs

 

 

NSITE Program Description
NSITE-PL: Search for consensus patterns of plant regulatory sequences

NSITE can be used for analysis of regulatory regions and composition of their functional motifs.

Method description:

The method is based on statistical estimation of expected number of a nucleotide consensus pattern in a given sequence [1-3]. NSITE-PL searches for statistically significant functional motifs of plant promoter/regulatory sequences. Plant functionally motifs is selected from RegSite Database developed by Softberry Inc. using published data on transcription regulation of plant genes.

If we find a pattern which has expected number significantly less than one, it can be expected that analyzed sequence possesses the pattern's function.

In the output of NSITE, we can see a pattern, its position in the sequence, accession number, ID, description of motif and binding factor name from the original database, if available.

Output example:

nsitep  Thu Jun 27 20:25:01 EDT 2002
 Program   N S I T E  (Softberry Inc.)
 Search for motifs of    432 Regulatory Elements from
 RegSite - The Transcription Regulatory Sites Database (Plants)
 (http://www.softberry.com)

 Number of QUERY Sequences:      1

 File of QUERY Sequences: /httpd/tmp/loadrun/pssp.seq.176588

 Search PARAMETERS:
     Expected  Mean  Number                 :  0.0100000
     Statistical Significance Level         :  0.9500000
     Print  Query  Sequence                 : No
     Special numbering of Query Sequence    : No
     Variation of Distance between RE Blocks: No


 NOTE: RE - Regulatory Element/Consensus
       AC - Accession No of RE in RegSite
       OS - Organism/Species
       BF - Binding Factor or One of them
       Mism.             - Mismatches
       Mean. Exp. Number - Mean Expected Number
       Up.Conf.Int.      - Upper Confidence Interval
==================================================

 QUERY: >Softberry SERVER PAST Sequence
 Length of Query Sequence:       2975
 Nucleotide Frequencies:  A -  0.30   G -  0.20   T -  0.26   C -  0.23

..................................................
 RE:    21. AC: RSP00021 /OS: Catharantus roseus /GENE: TDC /RE: GT-1#Box5 /BF: GT-1

 Motifs on "-" Strand: Mean Exp. Number   0.00915     Up.Conf.Int.  1     Found   1

     389  AAAAAGTAAAgA      378 (Mism.= 1)

..................................................
 RE:    34. AC: RSP00034 /OS: Zea mays /GENE: gamma-27kDa zein /RE: P-box (s) /BF: PB

 Motifs on "+" Strand: Mean Exp. Number   0.00002     Up.Conf.Int.  1     Found   1

    1353  GACGTGTAAAGTAAATTTACAAC     1375 (Mism.= 0)

..................................................
 RE:   183. AC: RSP00366 /OS: Nicotiana tabacum /GENE: CHN50 /RE: ERE /BF: TDBA12

 Motifs on "-" Strand: Mean Exp. Number   0.00849     Up.Conf.Int.  1     Found   1

    2826  TGACTTTCTGAt     2815 (Mism.= 1)

..................................................
 RE:   199. AC: RSP00395 /OS: Zea mays /GENE: gamma-27kDa zein /RE: O2-like-box /BF:

 Motifs on "+" Strand: Mean Exp. Number   0.00365     Up.Conf.Int.  1     Found   1

    1414  TTACGTAGAT     1423 (Mism.= 0)

..................................................
 RE:   234. AC: RSP00430 /OS: barley /GENE: Hor2 gene /RE: GSN; hor1-box; /BF: BLZ1;

 Motifs on "+" Strand: Mean Exp. Number   0.00918     Up.Conf.Int.  1     Found   1

    1221  GTGAGTCAT     1229 (Mism.= 0)

..................................................
 RE:   264. AC: RSP00459 /OS: coix /GENE: alpha-coixin /RE: O2u /BF: O2

 Motifs on "-" Strand: Mean Exp. Number   0.00384     Up.Conf.Int.  1     Found   1

     992  TTGACTAGGA      983 (Mism.= 0)

..................................................
 RE:   295. AC: RSP00491 /OS:  Zea mays /GENE: Zc2 /RE: Zc2 A/T-1 /BF: nuclear factor

 Motifs on "+" Strand: Mean Exp. Number   0.00000     Up.Conf.Int.  1     Found   1

     771  CATATGTTTTATTAAAacAAAaTTTATC      798 (Mism.= 3)

..................................................
 RE:   296. AC: RSP00492 /OS:  Zea mays /GENE: Zc2 /RE: Zc2 A/T-2 /BF: nuclear factor

 Motifs on "+" Strand: Mean Exp. Number   0.00000     Up.Conf.Int.  1     Found  10

     789  AaAatTtatcATATATATATATATATATATATATATATATAT      830 (Mism.= 7)
     791  AatTtatcATATATATATATATATATATATATATATATATAT      832 (Mism.= 6)
     793  tTtatcATATATATATATATATATATATATATATATATATAT      834 (Mism.= 5)
     795  tatcATATATATATATATATATATATATATATATATATATAT      836 (Mism.= 4)
     797  tcATATATATATATATATATATATATATATATATATATATAT      838 (Mism.= 2)
     799  ATATATATATATATATATATATATATATATATATATATATAT      840 (Mism.= 0)
     801  ATATATATATATATATATATATATATATATATATATATATAa      842 (Mism.= 1)
     803  ATATATATATATATATATATATATATATATATATATATAata      844 (Mism.= 3)
     805  ATATATATATATATATATATATATATATATATATATAatata      846 (Mism.= 5)
     807  ATATATATATATATATATATATATATATATATATAatataAa      848 (Mism.= 6)

 Motifs on "-" Strand: Mean Exp. Number   0.00000     Up.Conf.Int.  1     Found  10

     848  tTtatatTATATATATATATATATATATATATATATATATAT      807 (Mism.= 6)
     846  tatatTATATATATATATATATATATATATATATATATATAT      805 (Mism.= 5)
     844  tatTATATATATATATATATATATATATATATATATATATAT      803 (Mism.= 3)
     842  tTATATATATATATATATATATATATATATATATATATATAT      801 (Mism.= 1)
     840  ATATATATATATATATATATATATATATATATATATATATAT      799 (Mism.= 0)
     838  ATATATATATATATATATATATATATATATATATATATATga      797 (Mism.= 2)
     836  ATATATATATATATATATATATATATATATATATATATgata      795 (Mism.= 4)
     834  ATATATATATATATATATATATATATATATATATATgataAa      793 (Mism.= 5)
     832  ATATATATATATATATATATATATATATATATATgataAatT      791 (Mism.= 6)
     830  ATATATATATATATATATATATATATATATATgataAatTtT      789 (Mism.= 7)

..................................................
 Totally      27 motifs of     8 different REs have been found
=========================================================================================

References:

1. Shahmuradov K.A. Kolchanov N.A.Solovyev V.V.Ratner V.A.
Enhancer-like structures in middle repetitive sequences of the eukaryotic genomes.
Genetics (Russ),22, 357-368,(1986).

2. Solovyev V.V., Kolchanov N.A. 1994,
Search for functional sites using consensus In Computer analysis of Genetic macromolecules. (eds. Kolchanov N.A., Lim H.A.),
World Scientific, p.16-21.

3. Solovyev V.V. (2002) Structure, Properties and Computer Identification of Eukaryotic genes. In Bioinformatics from Genomes to Drugs. V.1. Basic Technologies. (ed. Lengauer T.), p. 59 - 111.

© 2020 www.softberry.com