HomeAll softwareProductsNew ProductsServicesManagement teamCorporate ProfileContact

Test online

Gene finding
Gene finding with similarity
Gene finding in Bacteria
Gene finding in Viruses
Next Generation
Gene search
Gene explorer
Promoter
Protein location
RNA structure
Protein structure
3d-explorer
SeqMan
Multiple alignment
Analysis of expression data
Plant promoter database
Search and map repeats
Extracting known SNPs

 

 

BestPal Window help

BestPal_window - the program for searching best "linear" rna secondary structure for long sequences with a window moving along the sequence.
Method description.
A window with user-defined size moves along the sequence.
For each position of the window the best palindrome is calculated by dynamic programming method without "brahching" of structures.
Only the best variant goes to output file.

BestPal_window parameters:
Window Length - user-defined window size moving along the sequence.

Output example:

Program PestPal (Softberry Inc.) | Version 2.2w

FoldRNA Vienna format:
Length: 590 Energy: -70.1

        10        20        30        40        50        60
UAUUAUCGUGUGCAGUUAAAAUUGACUUUUUAAUGCGGCUCCAUUUUUGGGUCGGUGUUU
............................................................
        70        80        90       100       110       120
ACUAUUUGAUCAAGGGCUUAAAUAUUUUUGUCUUAAUACGAAAAAACGCACAGAUUUGGU
............................................................
       130       140       150       160       170       180
AAAGGCUUAACUUAAAAUUUCAGCGCCCAAUCACCCCCUUCAGAGUUGCCACACGUUGUU
............................................................
       190       200       210       220       230       240
ACACUAAGUUAUCGAAACGAACAGCUGAUUUUUGUUUUGUAAUAUUUGAGGUUGGUUUUU
............................................................
       250       260       270       280       290       300
GUUGGCUGAAAUAUUAUUACAUUAAAUUAGAUAUGGACCUUUUACUUCAAAGCGUUUGAC
............................................................
       310       320       330       340       350       360
AAGUUGAACAUCAAACGGAAAUCUAUUAUAGCCCCAAUUGGCGAGACCAUCAAAUAAUCA
..............................(((....((((.(((((((((......(((
       370       380       390       400       410       420
UUGGAAAACAACCUGAGAUGAGUUUUCCAGACAAGGCGGAGCGCAAAAAGUGCUGGAACA
(((.....)))..))))))).)))))))))....))).......................
       430       440       450       460       470       480
ACCGGGACGAGUAUUGGAAAUGUCUCGAGGAGCACGCCCCAAAGCACAGUUCUACCAGUG
............................................................
       490       500       510       520       530       540
GGGAAAAGGUACCAACCCCCUGCCAGAGUCUUCGCAAAUCAUUUGAGCAAUCCUGCCCUG
............................................................
       550       560       570       580       590
GUCAAUGGGUAAAGCACUUCGACCGCAAGCGUACUUAUGACCAGUUUAAG
..................................................


FoldRNA GCG format:
Length: 590 Energy: -70.1

    1 U       0    2    0    1
    2 A       1    3    0    2
    3 U       2    4    0    3
    4 U       3    5    0    4
    5 A       4    6    0    5
    6 U       5    7    0    6
    7 C       6    8    0    7
    8 G       7    9    0    8
    9 U       8   10    0    9
   10 G       9   11    0   10
   11 U      10   12    0   11
   12 G      11   13    0   12
   13 C      12   14    0   13
   14 A      13   15    0   14
   15 G      14   16    0   15
   16 U      15   17    0   16
   17 U      16   18    0   17
   18 A      17   19    0   18
   19 A      18   20    0   19
   20 A      19   21    0   20
   21 A      20   22    0   21
   22 U      21   23    0   22
   23 U      22   24    0   23
   24 G      23   25    0   24
   25 A      24   26    0   25
   26 C      25   27    0   26
   27 U      26   28    0   27
   28 U      27   29    0   28
   29 U      28   30    0   29
   30 U      29   31    0   30
   31 U      30   32    0   31
   32 A      31   33    0   32
   33 A      32   34    0   33
   34 U      33   35    0   34
   35 G      34   36    0   35
   36 C      35   37    0   36
   37 G      36   38    0   37
   38 G      37   39    0   38
   39 C      38   40    0   39
   40 U      39   41    0   40
...
© 2020 www.softberry.com