HomeAll softwareProductsNew ProductsServicesManagement teamCorporate ProfileContact

Test online

Gene finding
Gene finding with similarity
Gene finding in Bacteria
Gene finding in Viruses
Next Generation
Gene search
Gene explorer
Promoter
Protein location
RNA structure
Protein structure
3d-explorer
SeqMan
Multiple alignment
Analysis of expression data
Plant promoter database
Search and map repeats
Extracting known SNPs

 

 

BestPal helix help

BestPal_helix calculates best palindrome for given rna sequence with restrictions.
In this version two types of restriction can be specified:
1) minimal helix length allowed
2) maximal secondary structure length allowed
Method description:
Dynamic programming method without "brahching" of structures with filters using specified restrictions.

BestPal_helix parameters:
Minimal spiral size - minimal helix length. If specified, then given minimal helix length allowed.
Maximum distance - maximal distance between begin and end of secondary structure. If specified, then given maximal secondary structure length allowed.

Output example:

Program BestPal (Softberry Inc.) | Version 2.1
Search for most stable hairpin (imperfect helices included)

FoldRNA Vienna format:
Length: 754 Energy: -7.8 3% in Helices

        10        20        30        40        50        60
UGCGGCGGAGACCGUGGUUUAGUGGGCCAAGGGUUCUACGAGUCGGAACACGUGUUAUCU
..((((...((((.((((((...))))))..))))......))))...............
        70        80        90       100       110       120
CUUGCGAAGAGUUUAAGGGUCCUGAGGGUGCGGAGUUGUGUUAUCAACCGAACACAGAAG
............................................................
       130       140       150       160       170       180
AAUCCCAAAUGAUGAAGCUGAGUCUCAUCAAAGUCGUUAAUGGCUGUCGUCUAGGAAAAA
............................................................
       190       200       210       220       230       240
UACAAAACCUGGGCAAAGCAGGGGACUGCACGGUGGACAUUCCGGGCUGUCUUCUCUACA
............................................................
       250       260       270       280       290       300
CCAGGACUGGCUCUGCCCCACACCUGACACAUCAGACGCUGCGUAACAUCCACGGGGUCC
............................................................
       310       320       330       340       350       360
CAGGCAUAGCCCAGCUCACACUCUCAUCCCUAGCAGAACAUCAUGAAGUCUUGGCAGAAU
............................................................
       370       380       390       400       410       420
AUAAGAAAGGAGUUGGAAGCUUUAUAGGCAUGCCGGAAUCACUCUUCUAUUGUUCCCUGC
............................................................
       430       440       450       460       470       480
ACGAUCCAGUCACCCCCGGCCCAGCUGGUUAUGUAACAAGUAAGGUCCUCCAGAAAAGUG
............................................................
       490       500       510       520       530       540
UGAUCAUUGGAGUGAUUGAGGGUGGAGAUGUGAUGGAAGAGAGGUUGAGGUCAGCACGAG
............................................................
       550       560       570       580       590       600
AGACAGCCAAGCGACCCGUCGGGGGCUUCCUGCUGGACGGCUUUCAAGGGGAUCCAGCAG
............................................................
       610       620       630       640       650       660
UCACAGAAACCAGACUGCACUUGCUGUCAUCAGUCACUGCAGAGCUGCCAGAGGACAAAC
............................................................
       670       680       690       700       710       720
CAAGGCUCAUCUGCGGUGUCAGCCGGCCAGACGAAGUGCUAGAGUGCAUCGAAAGGGGAG
............................................................
       730       740       750       760
UGGACUUGUUUGAGAGUUUUUUCCCAUAUCAAGU
..................................


Length = 754
==== structure 1 ====
Start	End	Energy
    3     45     -7.8
Helices: 3
    3 -    6	CGGC
   42 -   45	GCUG

   10 -   13	GACC
   32 -   35	UUGG

   15 -   20	UGGUUU
   24 -   29	ACCGGG



FoldRNA GCG format:
Length: 754 Energy: -7.8

    1 U       0    2    0    1
    2 G       1    3    0    2
    3 C       2    4   45    3
    4 G       3    5   44    4
    5 G       4    6   43    5
    6 C       5    7   42    6
    7 G       6    8    0    7
    8 G       7    9    0    8
    9 A       8   10    0    9
   10 G       9   11   35   10
   11 A      10   12   34   11
   12 C      11   13   33   12
   13 C      12   14   32   13
   14 G      13   15    0   14
   15 U      14   16   29   15
   16 G      15   17   28   16
   17 G      16   18   27   17
   18 U      17   19   26   18
   19 U      18   20   25   19
   20 U      19   21   24   20
   21 A      20   22    0   21
   22 G      21   23    0   22
   23 U      22   24    0   23
   24 G      23   25   20   24
   25 G      24   26   19   25
   26 G      25   27   18   26
   27 C      26   28   17   27
   28 C      27   29   16   28
   29 A      28   30   15   29
   30 A      29   31    0   30
   31 G      30   32    0   31
   32 G      31   33   13   32
   33 G      32   34   12   33
   34 U      33   35   11   34
   35 U      34   36   10   35
   36 C      35   37    0   36
   37 U      36   38    0   37
   38 A      37   39    0   38
   39 C      38   40    0   39
   40 G      39   41    0   40
   41 A      40   42    0   41
   42 G      41   43    6   42
   43 U      42   44    5   43
   44 C      43   45    4   44
   45 G      44   46    3   45
   46 G      45   47    0   46
   47 A      46   48    0   47
   48 A      47   49    0   48
   49 C      48   50    0   49
   50 A      49   51    0   50
   51 C      50   52    0   51
   52 G      51   53    0   52
   53 U      52   54    0   53
   54 G      53   55    0   54
   55 U      54   56    0   55
   56 U      55   57    0   56
   57 A      56   58    0   57
   58 U      57   59    0   58
   59 C      58   60    0   59
   60 U      59   61    0   60
   61 C      60   62    0   61
   62 U      61   63    0   62
   63 U      62   64    0   63
   64 G      63   65    0   64
   65 C      64   66    0   65
   66 G      65   67    0   66
   67 A      66   68    0   67
   68 A      67   69    0   68
   69 G      68   70    0   69
   70 A      69   71    0   70
   71 G      70   72    0   71
   72 U      71   73    0   72
   73 U      72   74    0   73
   74 U      73   75    0   74
   75 A      74   76    0   75
   76 A      75   77    0   76
   77 G      76   78    0   77
   78 G      77   79    0   78
   79 G      78   80    0   79
   80 U      79   81    0   80
   81 C      80   82    0   81
   82 C      81   83    0   82
   83 U      82   84    0   83
   84 G      83   85    0   84
   85 A      84   86    0   85
   86 G      85   87    0   86
   87 G      86   88    0   87
   88 G      87   89    0   88
   89 U      88   90    0   89
   90 G      89   91    0   90
   91 C      90   92    0   91
   92 G      91   93    0   92
   93 G      92   94    0   93
   94 A      93   95    0   94
   95 G      94   96    0   95
   96 U      95   97    0   96
   97 U      96   98    0   97
   98 G      97   99    0   98
   99 U      98  100    0   99
  100 G      99  101    0  100
  101 U     100  102    0  101
  102 U     101  103    0  102
  103 A     102  104    0  103
  104 U     103  105    0  104
  105 C     104  106    0  105
  106 A     105  107    0  106
  107 A     106  108    0  107
  108 C     107  109    0  108
  109 C     108  110    0  109
  110 G     109  111    0  110
  111 A     110  112    0  111
  112 A     111  113    0  112
  113 C     112  114    0  113
  114 A     113  115    0  114
  115 C     114  116    0  115
  116 A     115  117    0  116
  117 G     116  118    0  117
  118 A     117  119    0  118
  119 A     118  120    0  119
  120 G     119  121    0  120
  121 A     120  122    0  121

  ..........


© 2020 www.softberry.com