HomeAll softwareProductsNew ProductsServicesManagement teamCorporate ProfileContact

Test online

Gene finding
Gene finding with similarity
Gene finding in Bacteria
Gene finding in Viruses
Next Generation
Gene search
Gene explorer
Protein location
RNA structure
Protein structure
Multiple alignment
Analysis of expression data
Plant promoter database
Search and map repeats
Extracting known SNPs



Search for known SNPs in a given sequence in NCBI database.

Output example:

Sequences producing significant alignments:
gnl|dbSNP|rs1409128	rs=1409128|pos=301|len=601|taxid=9606|mol="cDNA"|class=1|alleles="A /C"|build=130|score(bits)=624
gnl|dbSNP|rs1409127	rs=1409127|pos=301|len=601|taxid=9606|mol="cDNA"|class=1|alleles="C /T"|build=126|score(bits)=624

gnl|dbSNP|rs17553802	rs=17553802|pos=274|len=452|taxid=9606|mol="cDNA"|class=1|alleles=" C/T"|build=123|score(bits)=575
gnl|dbSNP|rs3215811	rs=3215811|pos=404|len=452|taxid=9606|mol="cDNA"|class=2|alleles="- /A"|build=126|score(bits)=575
gnl|dbSNP|rs34136598	rs=34136598|pos=301|len=601|taxid=9606|mol="cDNA"|class=1|alleles=" C/T"|build=126|score(bits)=167
gnl|dbSNP|rs6573036	rs=6573036|pos=514|len=2741|taxid=9606|mol="cDNA"|class=1|alleles="A/ G"|build=130|score(bits)=159
gnl|dbSNP|rs4901588	rs=4901588|pos=2448|len=2741|taxid=9606|mol="cDNA"|class=1|alleles="C /T"|build=129|score(bits)=159
gnl|dbSNP|rs4901587	rs=4901587|pos=2394|len=2741|taxid=9606|mol="cDNA"|class=1|alleles="C /T"|build=129|score(bits)=159

gnl|dbSNP|rs2296544	rs=2296544|pos=61|len=121|taxid=9606|mol="cDNA"|class=1|alleles="C/ T"|build=100|score(bits)=149
>gnl|dbSNP|rs1409128 rs=1409128|pos=301|len=601|taxid=9606|mol="cDNA"|class=1|alleles="A /C"|build=130 Length = 347 Score = 624 bits (315), Expect = 1e-175 Identities = 336/347, (96%) Strand = Plus/Plus; Query: 1-347; Sbjct: 77-423; Query: 1 tcactgacatttcctaattaaccaagttctgccaagtttcacatgaaacttggggaaccg Sbjct: 77 ............................................................ Query: 61 atttcattcccccagtatcaccctgtggcgccaccttccggagctgtgaggaaactccgg Sbjct: 137 ............................................................ Query: 121 acttccccccaacaccgccccctccctccaccctcggtctccgctttctgcgctctgccg Sbjct: 197 ............................................................ Query: 181 cgttggttttcggaggtgtctgggcgcatgcgctttggacgggccgcctagcctaggaga Sbjct: 257 ............................................m............... Query: 241 gactacaattcccagaagacagtgcgaaagnnnnnnnnnntcccgcggtccgtgggggtg Sbjct: 317 ..............................aaaaaaaaaa.................... Query: 301 ggagaaataaacgctcgcgagagaacgaggttcaggcggctgcacga Sbjct: 377 ...............................................
>gnl|dbSNP|rs1409127 rs=1409127|pos=301|len=601|taxid=9606|mol="cDNA"|class=1|alleles="C /T"|build=126 Length = 347 Score = 624 bits (315), Expect = 1e-175 Identities = 336/347, (96%) Strand = Plus/Plus; Query: 1-347; Sbjct: 221-567; Query: 1 tcactgacatttcctaattaaccaagttctgccaagtttcacatgaaacttggggaaccg Sbjct: 221 ............................................................ Query: 61 atttcattcccccagtatcaccctgtggcgccaccttccggagctgtgaggaaactccgg Sbjct: 281 ....................y....................................... Query: 121 acttccccccaacaccgccccctccctccaccctcggtctccgctttctgcgctctgccg Sbjct: 341 ............................................................ Query: 181 cgttggttttcggaggtgtctgggcgcatgcgctttggacgggccgcctagcctaggaga Sbjct: 401 ............................................................ Query: 241 gactacaattcccagaagacagtgcgaaagnnnnnnnnnntcccgcggtccgtgggggtg Sbjct: 461 ..............................aaaaaaaaaa.................... Query: 301 ggagaaataaacgctcgcgagagaacgaggttcaggcggctgcacga Sbjct: 521 ...............................................
>gnl|dbSNP|rs17553802 rs=17553802|pos=274|len=452|taxid=9606|mol="cDNA"|class=1|alleles=" C/T"|build=123 Length = 328 Score = 575 bits (290), Expect = 1e-161 Identities = 316/328, (96%) Strand = Plus/Plus; Query: 1-328; Sbjct: 124-452; Query: 1 tcactgacatttcctaattaaccaagttctgccaagtttcacatgaaacttggggaaccg Sbjct: 124 ............................................................ Query: 61 atttcattcccccagtatcaccctgtggcgccaccttccggagctgtgaggaaactccgg Sbjct: 184 ............................................................ Query: 121 acttccccccaacaccgccccctccctccaccctcggtctccgctttctgcgctctgccg Sbjct: 244 ..............................y............................. Query: 181 cgttggttttcggaggtgtctgggcgcatgcgctttggacgggccgcctagcctaggaga Sbjct: 304 ............................................m............... Query: 241 gactacaattcccagaagacagtgcgaaagnnnnnnnnnn-tcccgcggtccgtgggggt Sbjct: 364 ..............................aaaaaaaaaan................... Query: 301 gggagaaataaacgctcgcgagagaacg Sbjct: 424 ............................
>gnl|dbSNP|rs3215811 rs=3215811|pos=404|len=452|taxid=9606|mol="cDNA"|class=2|alleles="- /A"|build=126 Length = 328 Score = 575 bits (290), Expect = 1e-161 Identities = 316/328, (96%) Strand = Plus/Plus; Query: 1-328; Sbjct: 124-452; Query: 1 tcactgacatttcctaattaaccaagttctgccaagtttcacatgaaacttggggaaccg Sbjct: 124 ............................................................ Query: 61 atttcattcccccagtatcaccctgtggcgccaccttccggagctgtgaggaaactccgg Sbjct: 184 ............................................................ Query: 121 acttccccccaacaccgccccctccctccaccctcggtctccgctttctgcgctctgccg Sbjct: 244 ..............................y............................. Query: 181 cgttggttttcggaggtgtctgggcgcatgcgctttggacgggccgcctagcctaggaga Sbjct: 304 ............................................m............... Query: 241 gactacaattcccagaagacagtgcgaaagnnnnnnnnnn-tcccgcggtccgtgggggt Sbjct: 364 ..............................aaaaaaaaaan................... Query: 301 gggagaaataaacgctcgcgagagaacg Sbjct: 424 ............................
>gnl|dbSNP|rs34136598 rs=34136598|pos=301|len=601|taxid=9606|mol="cDNA"|class=1|alleles=" C/T"|build=126 Length = 202 Score = 167 bits (84), Expect = 7e-38 Identities = 175/202, (85%) Strand = Plus/Plus; Query: 431-632; Sbjct: 360-558; Query: 431 ggtttgtatccgggctgtgaggtgctcggagcctcggcggaccttgctgcctctgtctct Sbjct: 360 ......g....a....a.........g........a.ta..a...t..........t... Query: 491 ttaacgcgagaggaagcgatgcagaggggtggaaaatggcagagctgcagatgttactag Sbjct: 420 ....t..a.......c....a....a.................................. Query: 551 aggaggagatcccgtctggcaagagggcgctgatcgagagttaccagaacctga-ctcgg Sbjct: 480 .....-.--...t....ca.........a.....a...................a.-.a. Query: 611 gtggcaga-ctactgtgaaaac Sbjct: 540 .....-..a..........g..
>gnl|dbSNP|rs6573036 rs=6573036|pos=514|len=2741|taxid=9606|mol="cDNA"|class=1|alleles="A/ G"|build=130 Length = 174 Score = 159 bits (80), Expect = 2e-35 Identities = 151/174, (86%) Strand = Plus/Plus; Query: 431-604; Sbjct: 2571-2741; Query: 431 ggtttgtatccgggctgtgaggtgctcggagcctcggcggaccttgctgcctctgtctct Sbjct: 2571 ......g....a....a.........g........a.ta..a...t..........t... Query: 491 ttaacgcgagaggaagcgatgcagaggggtggaaaatggcagagctgcagatgttactag Sbjct: 2631 ....t..a.......c....a....a.................................. Query: 551 aggaggagatcccgtctggcaagagggcgctgatcgagagttaccagaacctga Sbjct: 2691 .....-.--...t....ca.........a.....a...................
>gnl|dbSNP|rs4901588 rs=4901588|pos=2448|len=2741|taxid=9606|mol="cDNA"|class=1|alleles="C /T"|build=129 Length = 174 Score = 159 bits (80), Expect = 2e-35 Identities = 151/174, (86%) Strand = Plus/Plus; Query: 431-604; Sbjct: 2561-2731; Query: 431 ggtttgtatccgggctgtgaggtgctcggagcctcggcggaccttgctgcctctgtctct Sbjct: 2561 ......g....a....a.........g........a.ta..a...t..........t... Query: 491 ttaacgcgagaggaagcgatgcagaggggtggaaaatggcagagctgcagatgttactag Sbjct: 2621 ....t..a.......c....a....a.................................. Query: 551 aggaggagatcccgtctggcaagagggcgctgatcgagagttaccagaacctga Sbjct: 2681 .....-.--...t....ca.........a.....a...................
>gnl|dbSNP|rs4901587 rs=4901587|pos=2394|len=2741|taxid=9606|mol="cDNA"|class=1|alleles="C /T"|build=129 Length = 174 Score = 159 bits (80), Expect = 2e-35 Identities = 151/174, (86%) Strand = Plus/Plus; Query: 431-604; Sbjct: 2561-2731; Query: 431 ggtttgtatccgggctgtgaggtgctcggagcctcggcggaccttgctgcctctgtctct Sbjct: 2561 ......g....a....a.........g........a.ta..a...t..........t... Query: 491 ttaacgcgagaggaagcgatgcagaggggtggaaaatggcagagctgcagatgttactag Sbjct: 2621 ....t..a.......c....a....a.................................. Query: 551 aggaggagatcccgtctggcaagagggcgctgatcgagagttaccagaacctga Sbjct: 2681 .....-.--...t....ca.........a.....a...................
>gnl|dbSNP|rs2296544 rs=2296544|pos=61|len=121|taxid=9606|mol="cDNA"|class=1|alleles="C/ T"|build=100 Length = 77 Score = 149 bits (75), Expect = 2e-32 Identities = 76/77, (98%) Strand = Plus/Plus; Query: 394-470; Sbjct: 45-121; Query: 394 tgccgtcccacaataccaggcgggagggcgggtaggcggtttgtatccgggctgtgaggt Sbjct: 45 ................y........................................... Query: 454 gctcggagcctcggcgg Sbjct: 105 .................

© 2021 www.softberry.com