HomeAll softwareProductsNew ProductsServicesManagement teamCorporate ProfileContact

Test online

Gene finding
Gene finding with similarity
Gene finding in Bacteria
Gene finding in Viruses
Next Generation
Gene search
Gene explorer
Protein location
RNA structure
Protein structure
Multiple alignment
Analysis of expression data
Plant promoter database
Search and map repeats
Extracting known SNPs



Add known protein sequence from databases that is encoded by a given nucleotide sequence .

Output example:

>ABI1-EX1 dbj|BAD92505.1|Abl-interactor 1 variant [Homo sapiens] 100% 451-642 1 tcactgacatttcctaattaaccaagttctgccaagtttcacatgaaacttggggaaccg 61 atttcattcccccagtatcaccctgtggcgccaccttccggagctgtgaggaaactccgg 121 acttccccccaacaccgccccctccctccaccctcggtctccgctttctgcgctctgccg 181 cgttggttttcggaggtgtctgggcgcatgcgctttggacgggccgcctagcctaggaga 241 gactacaattcccagaagacagtgcgaaagaaaaaaaaaatcccgcggtccgtgggggtg 301 ggagaaataaacgctcgcgagagaacgaggttcaggcggctgcacgaagggggtggagGG 361 GGGCTGGAGAGAGTGAGGAGGAAGGGGAGGAGGTGCCGTCCCACAATACCAGGCGGGAGG 421 GCGGGTAGGCGGTTTGTATCCGGGCTGTGAGGTGCTCGGAGCCTCGGCGGACCTTGCTGC G A R S L G G P C C 481 CTCTGTCTCTTTAACGCGAGAGGAAGCGATGCAGAGGGGTGGAAAATGGCAGAGCTGCAG L C L F N A R G S D A E G W K M A E L Q 541 ATGTTACTAGAGGAGGAGATCCCGTCTGGCAAGAGGGCGCTGATCGAGAGTTACCAGAAC M L L E E E I P S G K R A L I E S Y Q N 601 CTGACTCGGGTGGCAGACTACTGTGAAAACAACTACATACAGgtgaggcgctctggcggc L T R V A D Y C E N N Y I Q 661 cggcgggcgctggccgggtcgaggacccgccggagtgaccagcccactgggcggggtggg 721 gaactgccctgacctcagcggctgccaccaacccgagcccctaccgcagccccaacccca 781 gccccaaccggggacagagcgagtggccgggctgagggagtcgggctgcgatacaggaag 841 tggctgtggtggtggaaaccgatagaaggggagagagaaaatgggcgagggagccgggag 901 cccgccgctgccgcagcccggcgcccccctcgcgtccgcttcccccagggcccggccacc 961 ggggtcgcgcgccccccaggtagcctccagtccgcagggc

© 2021 www.softberry.com